The entire resolvase recombination reaction can be reproduced " in vitro ", requiring only resolvase, a substrate DNA and multivalent cations, using either wild type protein or hyperactive mutants.
12.
Although the sequences of the inverted terminal repeats of the rudiviruses are different, they all carry the motif AATTTAGGAATTTAGGAATTT near the genome ends, which may constitute a signal for the Holliday junction resolvase and DNA replication.
13.
The MUS81-MMS4 endonuclease, although a minor resolvase for CO formation in " S . cerevisiae ", is crucial for limiting chromosome entanglements by suppressing multiple consecutive recombination events from initiating from the same DSB.
14.
The now classical members gamma-delta and Tn3 resolvase, but also new additions like ?C31-, Bxb1-, and R4 integrases, cut all four DNA strands simultaneously at points that are staggered by 2bp ( Fig . 2 ).
15.
During cleavage, a protein-DNA bond is formed via a transesterification reaction in which a phosphodiester bond is replaced by a phosphoserine bond between a 5 phosphate at the cleavage site and the hydroxyl group of the conserved serine residue ( S10 in resolvase ).
How to say resolvase in Hindi and what is the meaning of resolvase in Hindi? resolvase Hindi meaning, translation, pronunciation, synonyms and example sentences are provided by Hindlish.com.
